Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-590-3p enhances the radioresistance in glioblastoma cells by targeting LRIG1

doi: 10.3892/etm.2017.4697

Figure Lengend Snippet: Expression of miR-590 in human glioma tissues. *P<0.05, #P<0.01 vs. the normal group; &P<0.05 vs. grade I–II gliomas. miR, microRNA.

Article Snippet: Specific primers for miR-590-3p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) and miR-590-5p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). qPCR was performed using the SYBR-Green PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) in an ABI Prism 7900HT Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.).

Techniques: Expressing

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-590-3p enhances the radioresistance in glioblastoma cells by targeting LRIG1

doi: 10.3892/etm.2017.4697

Figure Lengend Snippet: Expression of miR-590 and LRIG1 in U251 and U251R cells. (A) Relative mRNA level of miR-590-3p and miR-590-5p in U251 and U251R cells. (B) Relative protein level of LRIG1 in U251 and U251R cells. *P<0.05, #P<0.01 vs. U251 cells. miR, microRNA; LRIG1, leucine-rich repeats and immunoglobulin-like domains protein 1; U251R, radioresistant U251.

Article Snippet: Specific primers for miR-590-3p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) and miR-590-5p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). qPCR was performed using the SYBR-Green PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) in an ABI Prism 7900HT Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.).

Techniques: Expressing

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-590-3p enhances the radioresistance in glioblastoma cells by targeting LRIG1

doi: 10.3892/etm.2017.4697

Figure Lengend Snippet: Effect of miR-590-3p on the radiosensitivity of U251R cells. U251R cells were exposed to radiation following transfection with the miR-590-3p inhibitor. (A) Relative mRNA level of miR-590-3p in U251R cells following transfection with the miR-590-3p inhibitor. (B) Cell viability of U251R cells following transfection with the miR-590-3p inhibitor. (C) Survival fraction of U251R cells following transfection with the miR-590-3p inhibitor. (D) Cell apoptosis rate of U251R cells following transfection with the miR-590-3p inhibitor. *P<0.05, #P<0.01 vs. NC. miR, microRNA; U251R, radioresistant U251; NC, negative control.

Article Snippet: Specific primers for miR-590-3p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) and miR-590-5p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). qPCR was performed using the SYBR-Green PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) in an ABI Prism 7900HT Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.).

Techniques: Transfection, Negative Control

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-590-3p enhances the radioresistance in glioblastoma cells by targeting LRIG1

doi: 10.3892/etm.2017.4697

Figure Lengend Snippet: Relative luciferase activity of wt or mut LRIG1 3′UTR in HEK293 cells following co-transfection with the NC or miR-590-3p mimic. #P<0.01 vs. NC. wt, wild type; mut, mutant; LRIG1, leucine-rich repeats and immunoglobulin-like domains protein 1; UTR, untranslated region; NC, negative control; miR, microRNA.

Article Snippet: Specific primers for miR-590-3p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) and miR-590-5p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). qPCR was performed using the SYBR-Green PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) in an ABI Prism 7900HT Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.).

Techniques: Luciferase, Activity Assay, Cotransfection, Mutagenesis, Negative Control

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-590-3p enhances the radioresistance in glioblastoma cells by targeting LRIG1

doi: 10.3892/etm.2017.4697

Figure Lengend Snippet: LRIG1 reversed the effect of miR-590-3p on the radiosensitivity of U251R cells. U251R cells were exposed to radiation following transfection. (A) Relative protein level of LRIG1 in U251R cells following transfection with the miR-590-3p inhibitor and LRIG1 siRNA. Lane 1, NC + scr si; lane 2, inhibitor + scr si; lane 3, inhibitor + LRIG1 si. (B) Cell viability of U251R cells following transfection with the miR-590-3p inhibitor and LRIG1 siRNA. (C) Survival fraction of U251R cells following transfection with the miR-590-3p inhibitor and LRIG1 siRNA. (D) Cell apoptosis rate of U251R cells following transfection with the miR-590-3p inhibitor and LRIG1 siRNA. *P<0.05, #P<0.01 vs. NC + scr si; &P<0.05, $P<0.01 vs. inhibitor + scr si. LRIG1, leucine-rich repeats and immunoglobulin-like domains protein 1; miR, microRNA; U251R, radioresistant U251; si, short interfering; NC, negative control; scr, scramble.

Article Snippet: Specific primers for miR-590-3p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) and miR-590-5p (forward, 5′-TAATTTTATGTATAAGCTAGT-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′) were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). qPCR was performed using the SYBR-Green PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) in an ABI Prism 7900HT Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.).

Techniques: Transfection, Negative Control

Journal: Investigative Ophthalmology & Visual Science

Article Title: Fosfenopril Attenuates Inflammatory Response in Diabetic Dry Eye Models by Inhibiting the TLR4/NF-κB/NLRP3 Signaling Pathway

doi: 10.1167/iovs.65.6.2

Figure Lengend Snippet: List of Primers

Article Snippet: Reverse , 5′TGGATGCCACAGGACTCCAT3′ , Sangon Biotech.

Techniques:

Journal: Molecular Medicine Reports

Article Title: Phellinus gilvus -derived protocatechualdehyde induces G0/G1 phase arrest and apoptosis in murine B16-F10 cells

doi: 10.3892/mmr.2019.10896

Figure Lengend Snippet: KEGG pathway analysis of the p53 signaling pathway regulated by PCA. Copyright permission was granted by Kanehisa Laboratories to adapt a KEGG pathway map for this figure. PCA, protocatechualdehyde.

Article Snippet: An initial activation at 95°C for 2 min was followed by an amplification target sequence of 40 cycles of 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec. PCR primers were synthesized by Shanghai Shenergy Biocolor BioScience & Technology Co., Ltd. as follows: p53-induced death domain-containing protein 1 (PIDD) forward 5′-GGGAACCAGTTGAACTTGGAC-3′, reverse 5′-CTGAGCCGCAAAAACTCCAC-3′; p21 forward 5′-CCTGGTGATGTCCGAC-CTG-3′, reverse 5′-CCATGAGCGCATCGCAATC-3′; Cyclin E forward 5′-TCT-TCACACAGATGACACAAGC-3′, reverse 5′-CAACAGCAACCTACAACACCC-3′; Bax forward 5′-AGACAGGGGCCTTTTTGCTAC-3′, reverse 5′-AATTCGCCG-GAGACACTCG-3′; Cyclin D forward 5′-TCAAGTGTGACCCGGACTG-3′, reverse 5′-ATGTCCACATCTCGCACGTC-3′; growth arrest and DNA damage-inducible 45 (Gadd45) forward 5′-CCGAAAGGATGGACACGGTG-3′, reverse 5′-TTATCGGGGTCTACGTTGAGC-3′; p53 forward 5′-CACAGCACATGACGG-AGGTC-3′, reverse 5′-TCCTTCCACCCGGATAAGATG-3′; Bcl-2 forward 5′-GCTACCGTCGTGACTTCGC-3′, reverse 5′-CCCCACCGAACTCAAAGAAGG-3′; cell division cycle-associated protein 2 (Cdc-2) forward 5′-AGAAGGTACTTACGG-TGTGGT-3′, reverse 5′-GAGAGATTTCCCGAATTGCAGT-3′; Cyclin B forward 5′-AAGGCCAAGGTCAGTATGGC-3′, reverse 5′-CTTGCCTGTAGCTCTTCGCT-3′; phosphatidylinositol glycan anchor biosynthesis class S (PIGs) forward 5′-TCT-GTCCCCGATTTCCCCC-3′, reverse 5′-AGCTGCTTCAAGACTTCCGC-3′; GAPDH forward 5′-AAGAAGGTGGTGAAGCAGG-3′, reverse 5′-GAAGGTGGA-AGAGTGGGAGT-3′.

Techniques:

Journal: Molecular Medicine Reports

Article Title: Phellinus gilvus -derived protocatechualdehyde induces G0/G1 phase arrest and apoptosis in murine B16-F10 cells

doi: 10.3892/mmr.2019.10896

Figure Lengend Snippet: mRNA expression analysis of p53-related genes in B16-F10 cells treated with and without 50 µg/ml PCA for 48 h. mRNA expression level of the following genes: (A) PIDD, p21, cyclin E and Bax; and (B) cyclin D, Gadd45, p53, Bcl-2, Cdc-2, cyclin B and PIGs. Density values were normalized to GAPDH. Data are presented as the mean ± SD from three experiments per group. **P<0.01 vs. control. PCA, protocatechualdehyde; Gadd45, growth arrest and DNA damage-inducible 45; PIDD, p53-induced death domain-containing protein 1; Cdc-2, cell division cycle-associated protein 2; PIGs, phosphatidylinositol glycan anchor biosynthesis class S.

Article Snippet: An initial activation at 95°C for 2 min was followed by an amplification target sequence of 40 cycles of 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec. PCR primers were synthesized by Shanghai Shenergy Biocolor BioScience & Technology Co., Ltd. as follows: p53-induced death domain-containing protein 1 (PIDD) forward 5′-GGGAACCAGTTGAACTTGGAC-3′, reverse 5′-CTGAGCCGCAAAAACTCCAC-3′; p21 forward 5′-CCTGGTGATGTCCGAC-CTG-3′, reverse 5′-CCATGAGCGCATCGCAATC-3′; Cyclin E forward 5′-TCT-TCACACAGATGACACAAGC-3′, reverse 5′-CAACAGCAACCTACAACACCC-3′; Bax forward 5′-AGACAGGGGCCTTTTTGCTAC-3′, reverse 5′-AATTCGCCG-GAGACACTCG-3′; Cyclin D forward 5′-TCAAGTGTGACCCGGACTG-3′, reverse 5′-ATGTCCACATCTCGCACGTC-3′; growth arrest and DNA damage-inducible 45 (Gadd45) forward 5′-CCGAAAGGATGGACACGGTG-3′, reverse 5′-TTATCGGGGTCTACGTTGAGC-3′; p53 forward 5′-CACAGCACATGACGG-AGGTC-3′, reverse 5′-TCCTTCCACCCGGATAAGATG-3′; Bcl-2 forward 5′-GCTACCGTCGTGACTTCGC-3′, reverse 5′-CCCCACCGAACTCAAAGAAGG-3′; cell division cycle-associated protein 2 (Cdc-2) forward 5′-AGAAGGTACTTACGG-TGTGGT-3′, reverse 5′-GAGAGATTTCCCGAATTGCAGT-3′; Cyclin B forward 5′-AAGGCCAAGGTCAGTATGGC-3′, reverse 5′-CTTGCCTGTAGCTCTTCGCT-3′; phosphatidylinositol glycan anchor biosynthesis class S (PIGs) forward 5′-TCT-GTCCCCGATTTCCCCC-3′, reverse 5′-AGCTGCTTCAAGACTTCCGC-3′; GAPDH forward 5′-AAGAAGGTGGTGAAGCAGG-3′, reverse 5′-GAAGGTGGA-AGAGTGGGAGT-3′.

Techniques: Expressing